ec42 non template strand (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
93
Structured Review
Bio-Rad
ec42 non template strand
Ec42 Non Template Strand, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ec42+non+template+strand/Liquichek+ANA+Control/pmc06589119-232-5-76
Average 93 stars, based on 20 article reviews
Ec42 Non Template Strand, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ec42+non+template+strand/Liquichek+ANA+Control/pmc06589119-232-5-76
Average 93 stars, based on 20 article reviews
ec42 non template strand - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Labeling:Article Title: Single-molecule FRET method to investigate the dynamics of transcription elongation through the nucleosome by RNA polymerase II Article Snippet: .. EC42 Template Strand: 5’P−CTGCGCCACCGCGGTCTAGAGGATCCCCGGGAGTGGAATGAGAAATGAGTGTGAAGATAGAGGAGAGATCAAAAAAATTA 3’ EC42 Non-template Strand: 5’CTCCTCTATCTTCACACTCATTTCTCATTCCACTCCCGGGGATCCTCTAGACCGCGGTGGC 3’ Top strand (labeled with Cy5 at +35 and with Cy3 at +112) GCAGATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCAGT Bottom strand ACTGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCGAT list-behavior=enumerated prefix-word= mark-type=decimal max-label-size=0 An equal molar amount of template oligo is added and the two strands are annealed by incubating at 95°C for 5 minutes followed by gradual |